Warning: file(http://tymek10.nazwa.pl/statlink/tagi_blogi/bzp-bartnik.pl.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra17/ftp/bzp-bartnik.pl/media/data.php on line 47
PIC-651

PIC-651

Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego ad 7

Pomimo jedynie 2-krotnego wzrostu aktywności PGIS, myszy eksprymujące PGIS narażone na przewlekłe niedotlenienie nie wykazały żadnych dowodów na nadciśnienie płucne i miały RVSP, który był o 60% niższy niż u ich nietransgenicznych matek. RVSP dla transgenicznych zwierząt nie zmieniła się od linii podstawowej po 5 tygodniach przewlekłego niedotlenienia. Ponadto, grubość ś...

Więcej »

Receptor wykrywający wapń jest wymagany do prawidłowej homeostazy wapnia, niezależnie od hormonu przytarczyc ad 6

Porównano kości z miotów z niedoborem CaR i miotami z ekspresją CaR (wszystkie Pth A / b) utrzymywane na diecie wysokobiałkowej. Analiza histologiczna odcinków kości udowej i piszczelowej z Pth. /. CaR. /. myszy nie wykazały widocznych różnic w porównaniu z osobnikami z miotu kontrolnego (dane nie przedstawione). Jednak mikroskopia świetlna fragmentów kości kręgowej...

Więcej »

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics...

Więcej »

Zobacz też:

Komplementacja genu HLA-DQ i inne powiązania zgodności tkankowej u człowieka z odpowiedzią autoprzeciwciała anty-Ro / SSA tocznia rumieniowatego układowego.

Amplifikacja PCR i analiza sekwencji eksonu 45 dystrofiny na genomowym DNA pochodzącym z krwi obwodowej DMD-BMT1 (limfocyty T i komórki mieloidalne) oraz jego rodzice ujawnili polimorfizm 143 zasad w eksonie 45 flankującym intron. Matka była najwyraźniej homozygotyczna pod względem G, podczas gdy ojciec i DMD-BMT1 mieli A w tej pozycji (rysunek 1c). Ponieważ DMD jest zaburzeniem sprz...

Więcej »
501#afta język , #pęcherz na skórze , #ćwiczenia na rzeźbę brzucha , #choroba legionisty , #freud sny , #na oczyszczenie organizmu , #torbiel w piersiach leczenie , #poród balonik , #rossmann inglot , #laseroterapia w kosmetologii ,