Warning: file(http://tymek10.nazwa.pl/statlink/tagi_blogi/bzp-bartnik.pl.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra17/ftp/bzp-bartnik.pl/media/data.php on line 47

Warning: file(http://tymek10.nazwa.pl/statlink/tagi_low_blogi/bzp-bartnik.pl.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra17/ftp/bzp-bartnik.pl/media/data.php on line 48
bzp-bartnik - galeria - obraz BZP#WN-912-PIC-9

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). An...

Ocena aktywności choroby w dystrofiach mięśniowych za pomocą nieinwazyjnego obrazowania cd

Jako dodatkowe kontrole, wstrzyknięto myszom Dysf. /. / Pax7CreER / LuSEAP sam nośnik (olej kukurydziany) i nie znaleziono dowodów na ekspresję lucyferazy (Suplementowa Figura 4A). U myszy leczonych tamoksyfenem sygnał lucyferazy gwałtownie wzrastał w czasie w mięśniach kończyn tylnych szczepu z niedoborem dysferliny, ale nie w szczepie typu dzikiego (figura 2, B i C, i dodatkowa postać 4B). Ta zwiększona aktywność regeneracyjna u myszy z niedoborem dysferliny była widoczna już w wieku 3 miesięcy i wzrastała w sposób ciągły przez...

Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 6

Lizę przeprowadzono w obecności TX-114. SI poddano immunoprecypitacji z fazy wodnej (S) i detergentowej (P), potraktowano Endo H i analizowano za pomocą SDS-PAGE na żelu 6% w żelu, a następnie fluorografia. Dodatkowy prążek pojawiający się w próbkach L340P w aib jest wskazywany przez groty strzałek. W świetle danych z analizy impulsów widać, że skrócona forma pro-SI była prekursorem wydzielanych gatunków i jako taka była również białkiem hydrofilowym. Aby to potwierdzić, zbadaliśmy zdolność do ekstrakcji detergentem w TX-11...

Zobacz też:

Odrebna jednostka chorobowa jest nagminne zapalenie slinianek

Porównanie sekwencji między ludzkim B5 i TSH-a a także A2 i wspólne. podjednostka (A). (b) Drożdżowe dwuhybrydowe analizy oddziaływań między A2 i różnymi genami podjednostek w rodzinie hormonów glikoproteinowych. Komórki drożdży transfekowano plazmidami kodującymi A2 i różne geny podjednostek poddane fuzji z domeną aktywującą GAL4 i domeną wiążącą, odpowiednio. Wyraźny wzrost kolonii wyrażających A2 i B5 wskazuje na silne oddziaływanie między tymi białkami. Zaobserwowano również interakcje między A2 i CG-...

Najnowsze zdjęcia w galerii bzp-bartnik:


Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 154

Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 156

Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 158


Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 162

Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 164

Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 166


Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 170

Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 172

Notice: Undefined variable: end in /home/hydra17/ftp/bzp-bartnik.pl/media/index.php on line 175

1