Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. -C. różnorodna immunologiczna analiza immunologiczna TCRVB. Jak opisano poprzednio (51), cDNA otrzymany z PBMC P3 amplifikowano z każdym ze starterów specyficznych dla rodziny 24 TCRVB razem ze starterem TCRBC i sondą MGB-TaqMan (Applied Biosystems) dla TCRBC. Ilościowa reakcja PCR w czasie rzeczywistym została przeprowadzona w systemie ABI PRISM 7300 (Applied Biosystems). Produkty PCR poddano następnie reakcjom spływu stosując zagnieżdżony fluorescencyjny primer specyficzny dla C. człon. Produkty fluorescencyjne rozdzielono i analizowano na sekwenatorze 373A (Applied Biosystems). Wielkość i intensywność każdego pasma analizowano za pomocą oprogramowania Immunoscope (52). Rozkład Gaussa różnych długości CDR3 był charakterystyczny dla normalnego V. repertuar. TCRV ilościowa analiza immunoskopowa. Jak opisano poprzednio (36), cDNA wytworzony z 0,2 mg RNA amplifikowano w całkowitej objętości 25 ul z każdym z 6 TCRV. i 6 TCRV. primery specyficzne dla rodzin TCRV, w połączeniu z C. lub C. Elementarz. Ilościowa reakcja PCR w czasie rzeczywistym została przeprowadzona w systemie ABI PRISM 5700 (Applied Biosystems) i zoptymalizowana pod kątem testu zielonego barwnika SYBR. Schemat cykli PCR był następujący: ogrzewanie przez 10 minut w 95 ° C, a następnie 40 cykli 15 sekund w 95 ° C i minuta w 60 ° C. Podczas PCR zielony barwnik SYBR wiąże się z dwuniciowym DNA; wzrost fluorescencji jest zatem proporcjonalny do stężenia DNA. Produkty PCR zostały następnie poddane reakcjom spływu przy użyciu zagnieżdżonych starterów fluorescencyjnych specyficznych dla C. lub C. człon. Produkty fluorescencyjne rozdzielono i analizowano na sekwenatorze 373A. Wielkość i intensywność każdego pasma analizowano za pomocą oprogramowania Immunoscope. Intensywność fluorescencji wykreślono w dowolnych jednostkach na osi y, podczas gdy oś x odpowiada długości CDR3 w aminokwasach. Zastosowano specyficzne i stałe startery dla rodziny genów V, zorientowane 5. do 3 (3, były następujące: V. 2: TACCGAGAAAAGGACATCTATGGC; C .: TGGGAGAGATGACAATAGCAGGATC; C. -Fam: ACGGATGGTTTGGTATGAGGCTGA; V. 4: CGGAAGCACAAGGAAGAACTTGAGAAT; C .: GAATCGTGTTGCTCTTCTTTTCTTGCC; i C. -fam: ATAGTGGGCTTGGGGGAAACATC. Analiza sekwencji transkryptów TCR. PCR V-3-C. lub V3-3C. przeprowadzono na cDNA P4 z 5 U polimerazy Pfu (Stratagene) przez 25 cykli. Produkty PCR zostały następnie sklonowane do wektora pCRa-tnt II . TOPO przy użyciu zestawu do klonowania Zero Blunt TOPO PCR (Invitrogen Corp.). Do celów sekwencjonowania PCR przeprowadzono bezpośrednio na koloniach E. coli z użyciem polimerazy Taq. Przeprowadzono reakcje sekwencjonowania na tych produktach przy użyciu C. lub C. primers i ABI PRISM Big Dye Terminator Cycle Sequencing Kit Reaction Kit (Applied Biosystems). Te reakcje sekwencjonowania przeprowadzono na analizatorze DNA ABI PRISM 3730. Sekwencje odpowiadające regionowi CDR3 ekstrahowano i analizowano. Podziękowania Dziękujemy Markowi Lathropowi z Center National de Génotypage (Evry) za doradztwo naukowe i Nathalie Lambert, Cécile Dumont, Corinne Jacques i Chantal Harré (Centre d Etude des Déficits Immunitaires) za fachową pomoc techniczną. Prace te były wspierane przez instytucjonalną dotację INSERM, EUROPOLICY-PID nr. PL 006411 i Telethone / AFM przyznają GAT0203 i Institut Pasteur. Przypisy Patrz odnośny komentarz od strony 2974. Zastosowano niestandardowe skróty: BMT, przeszczep szpiku kostnego; OS, zespół Omenna; P2, pacjent 2; PHA, fitohemaglutynina; RAG1, gen aktywujący rekombinację 1; TCRVB, zmienna receptora komórek T. łańcuch. Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów.
[hasła pokrewne: klinika stomatologiczna łódź, finasteryd skutki uboczne, łysoń sklep ]
[patrz też: dom latających sztyletów cda, depilacja brazylijska poznań, czym słodzić zamiast cukru ]