Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T czesc 4

HVEM. /. myszy wykazywały znacząco wyższe i przedłużone poziomy cytokin w surowicy pomiędzy 2 a 6 godziną po traktowaniu ConA. Takie wysokie i przedłużone poziomy cytokin mogą przyczyniać się do zwiększonej zachorowalności i śmiertelności w HVEM. /. Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T czesc 4”

Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T cd

Co ciekawe, urządzenia APC firmy HVEM. /. myszy były bardziej aktywne w stymulowaniu komórek T niż myszy WT. Wyniki te potwierdzają, że HVEM może być ujemnym regulatorem aktywacji limfocytów T, co jest jaskrawym przeciwieństwem jego aktywności kostymulacji w aktywacji limfocytów T, przedstawionej w poprzednich badaniach. Następnie zbadaliśmy, czy LIGHT, dobrze zdefiniowany ligand HVEM, jest zaangażowany w negatywną regulację aktywacji komórek T za pośrednictwem HVEM. Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T cd”

Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad

Oczekiwany rozmiar fragmentu po hybrydyzacji z 5. sonda flankująca (trawienie EcoRI genomowego DNA) wynosi około 17 kb dla allelu WT i 10 kb dla inaktywowanego allelu. EN-2, miejsce zaakceptowania sklejanego 2 spawów; lacZ, a-ekspresyjna kaseta ekspresyjna; pA, sygnał poliadenylacji; DSE, dalszy element; neo, kaseta genowa oporności na neomycynę; HSV-TK, kaseta ekspresyjna kinazy tymidynowej herpeswirusa. (B) Analiza typu Southerna myszy po przeniesieniu mutacji HVEM linii zarodkowej. Pokazano hybrydyzację strawionego EcoRI DNA przedstawiciela myszy (E14, kontrolny DNA z komórek E14.1 ES). Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad”

Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T

Mediator wnikania do wirusa opryszczki (HVEM), członek nadrodziny receptora TNF, został wcześniej opisany jako receptor kostymulacyjny komórek T. Co zaskakujące, HVEM. /. Komórki T wykazywały zwiększoną odpowiedź na stymulację in vitro konkanawaliną A (ConA) w porównaniu z komórkami T WT. Zgodnie z tymi ustaleniami, HVEM. Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 6

CMV wykrywano we krwi (miano wirusa określone przez PCR: 39 800 kopii / ml krwi), w aspiratach oskrzelowych iw moczu. Niedobór odporności tego pacjenta był leczony przez haploidentyczne przeszczepienie szpiku kostnego za pomocą limfocytów T (BMT), z matką jako dawcą, po schemacie kondycjonowania. Ostra GVHD, wraz z reaktywacją choroby CMV, spowodowała śmierć pacjenta 150 dni po BMT. P2. P2, dziewczynka urodzona po rodzicach pochodzenia kuzynów pochodzenia marokańskiego po ciążach bez powikłań, została skierowana do szpitala Necker-Enfants Malades w wieku 5 miesięcy. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 6”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 5

Doniesiono, że komórki T występują u biorców przeszczepów nerki rozwijających zakażenie CMV (23). W tym przypadku większość wykrytych komórek T V. 1+ i V. 3+ aktywowano in vitro przez CMV, wykazując ich swoistość (23, 25). Analiza różnorodności połączeń w tych komórkach + T wykazała, że rozkład wielkości komórek CDR3 był ograniczony, co wskazuje na prawdopodobną selektywną ekspansję klonów specyficznych dla antygenu (36). Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 5”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV czesc 4

Wadę rekombinacyjną AV (D) J rozważono. Skan całego genomu wykrył wiązanie w regionie 11p, w którym znajdują się geny kodujące RAG1 / RAG2. Przyczyną występowania mutacji RAG1 u tych pacjentów wykazano na dwa sposoby: (a) pomimo dokładnych badań immunologicznych nie wykryto żadnej innej znanej przyczyny pierwotnego niedoboru odporności, oraz (b) 3 z 4 mutacji wykrytych u tych pacjentów zostały zidentyfikowano u pacjentów z niedoborem odporności zwanym zespołem Omenna (mutacje stwierdzone w P1 i P4) lub atypowym zespole Omenna (mutacja znaleziona w P3) (11, 13, 29. 31). Stwierdzono, że mutacje te są hipomorficzne: del T631 i del 368a369 prowadzą do translacji, wychodząc z alternatywnego miejsca inicjacji, w drugim kodonie metioninowym poniżej delecji (31). Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV czesc 4”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV cd

Jednak stężenia przeciwciał przeciwko toksoidowi tężcowi i wirusowi polio w surowicy były bardzo niskie w P2 po immunizacji (tabela 3), co wskazuje na funkcjonalny niedobór komórek B. Tabela 3 Oznaczenia przeciwciał IgG i przeciwciał Wykrywanie homozygotycznych mutacji RAG1. Występowanie ciężkich oportunistycznych zakażeń związanych z głęboko nieprawidłowymi rozkładami podzbiorów komórek T u tych pacjentów urodzonych u rodziców pokrewnych sugerowało autosomalną recesywną odziedziczoną postać ciężkiego niedoboru komórek T. NK. Fenotyp SCID został wykluczony przez obecność komórek NK, a testy enzymatyczne wyłączały deaminazę adenozynową i purynowe defekty fosforylazy nukleozydowej. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV cd”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad

Ten niedobór TCR. + T utrzymywał się przez kilka miesięcy (dane nie pokazane). Kontrola zakażenia CMV przez terapię przeciwwirusową nie miała wpływu na TCR. Liczba komórek T (dane nie pokazane). Zarówno CD4 + i CD8 + TCR. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad”