Pdx1 przywraca funkcja komórek w myszach z nokautem Irs2 ad

Pomiary losowych dawek glukozy i insuliny wykonano zgodnie z wcześniejszym opisem (4). Dootrzewnowe testy tolerancji glukozy przeprowadzono na myszach poszczących przez 15-16 godzin z 2 g D-glukozy na kg masy ciała, jak opisano wcześniej (2). Dootrzewnowe testy tolerancji insuliny przeprowadzono na karmionych myszach za pomocą 0,75 jednostki ludzkiej insuliny na kg masy ciała, jak opisano wcześniej (2). Immunohistochemia. Immunohistochemiczną lokalizację antygenów i immunohistochemiczną metodą podwójnego znakowania przeprowadzono analogicznie do wcześniej opisanych metod (4). Próbki trzustki wycięto z myszy karmionych i utrwalono roztworem Bouina przez noc. Pięć mikrometrowych przekrojów wzdłużnych bloków parafinowych uwodniono ponownie ksylenem, a następnie zmniejszono stężenia etanolu, ogrzewano mikrofalami w 0,01 M cytrynianie sodu (pH 6,0) przez 20 minut i permeabilizowano za pomocą 1% Triton X-100 w PBS przed pierwotną inkubacją surowicy odpornościowej. Morfometria wysepek została przeprowadzona podobnie do wcześniej opisanych metod (4). Pierwotnymi przeciwciałami były: przeciwciało przeciwko króliczej insulinie i królicze przeciwciała anty-glukagonowe (Zymed Laboratories Inc., South San Francisco, Kalifornia, USA), królicze N-końcowe przeciw-Pdx1 (od CVE Wright) i mysie przeciw-BrdU (Roche Molecular Biochemicals, Indianapolis, Indiana, USA). Wtórne przeciwciała znakowano FITC lub rhodaminą (Jackson ImmunoResearch Laboratories Inc., West Grove, Pennsylvania, USA). Morfometria wysepek. Noworodek (dzień postnatalny [P] 0,5. 1,5). pole powierzchni komórek oznaczono ilościowo, uzyskując sąsiadujące x 10 zdjęć całej nowonarodzonej trzustki z dwóch wybarwionych anty-insuliną fragmentów na zwierzę, co najmniej sześć zwierząt na genotyp (zgrupowano osobników płci męskiej i żeńskiej), z mikroskopem Zeiss Axiovert (Carl Zeiss MicroImaging). , Thornwood, New York, USA). Obrazy analizowano dla obszaru za pomocą oprogramowania do oznaczania gęstości oprogramowania Openvision Open Lab (Improvision Scientific Imaging, Lexington, Massachusetts, USA). Dla każdego zwierzęcia stosunek. powierzchnię komórki do całkowitej powierzchni trzustki obliczono i podano jako średnią. SEM. Dorosły. obszar komórek mierzono, nabywając obrazy z dwóch zestawów od ośmiu do dziesięciu losowych nienakładających się obrazów w x10 wybarwionych insuliną i glukagonem sekcji od samców myszy, co najmniej czterech zwierząt na genotyp. Wyniki. Oznaczenie ilościowe komórek wyrażono jako procent całkowitej powierzchni badanej zawierającej komórki dodatnie pod względem insuliny. Gęstość wysepek i wielkość wyliczono z wychwyconych obrazów wybarwionych insuliną. Wskaźniki. do . komórki obliczono ze średnich obszarów komórek z insuliną i glukagonem dodatnim. Rozmieszczenie wysp i. Wielkość komórki badano przez wstrzyknięcie 2- do 3-tygodniowych samców myszy z 5-bromo-2-deoksyurydyną (BrdU, Roche Molecular Biochemicals, Indianapolis, Indiana, USA, 100 .g / g masy ciała) i wykonanie podwójnej etykiety immunohistochemia insuliny i BrdU na ponownie uwodnionych odcinkach zatopionych w parafinie u myszy. Obrazy każdej wysepki na sekcję uzyskano po x 63. BrdU-pozytywne. wskaźniki komórek zostały obliczone jako średnia. SEM z BrdU-dodatniego. komórki w sumie. komórki na sekcję, dwie sekcje na zwierzę, trzy do czterech zwierząt na genotyp. Rozmiar . komórki określono przez podzielenie całości. obszar komórek według liczby. komórki badane na sekcję. RT-PCR i Western blotting. Wysepki izolowano od 6-tygodniowego męskiego osobnika typu dzikiego, Irsl. / ., i Irs2. /. myszy za pomocą trawienia Collagenase P (Liberase HI, Roche Molecular Biochemicals) (17) i całkowitego RNA ekstrahowano za pomocą Trizol (GIBCO BRL, Life Technologies Inc., Grand Island, Nowy Jork, USA) i RNeasy (QIAGEN Inc., Valencia, California , USA). Syntezę cDNA przeprowadzono przy użyciu zestawu RETROscript (Ambion Inc., Austin, Texas, USA), a następnie ilościowego PCR (TaqMan (Applied Biosystems, Foster City, California, USA) (50 ° C przez 2 minuty, 95 ° C przez 10 minut, następnie 40 cykli w 95 ° C przez 15 sekund, 60 ° C przez minutę) przeprowadzono za pomocą ABI Prism 7700 PCRinstrument (Applied Biosystems) w celu powielenia próbek w trzech powtórzeniach dla Pdx1, Hnf1a, Hnf1a, Hnf3a. (Foxa2), Hnf4a i geny cyklofilin. Startery były następujące: Pdx1 forward, AGGAAAACAAGAGGACCCGTACT; Sonda Pdx1, CCTACACCCGGGCGCAGCTG; Pdx1 reverse, CGGGAGATGTATTTGTTAAATAAGAATTC; Hnf1. naprzód, TGCGTTCTACAACTGGTTTGC; Hnf1. sonda, AGGCTTCCTCCTTGCGCCGG; Hnf1. reverse, GGAGGTCCGTTATAGGTGTCCAT; Hnf1. naprzód, GAGGAGTGTAACAGGGCAGAATGT; Hnf1. sonda, CCTTCCAAAGCCCACGGCCTAGG; Hnf1. wstecz, GGACCTCCGTGACCAAGTTG; Hnf3. naprzód, GAACTCCATCCGCCACTCTCT; Hnf3. sonda, TCAACGACTGCTTTCTCAAGGTGCCC; Hnf3. reverse, GCCCTTGCCAGGCTTGT; Hnf4. naprzód, ACGTGCTGC-TCCTAGGCAAT; Hnf4. sonda, CACACGGCTCATCTCCGCTAGCTCTG; Hnf4. reverse, TCGAGGATGCGGATGGA; cyclophillin naprzód, CAGACGCCACTGTCGCTTT; sonda cyklofilowa, CCTACACCCGGGCGCAGCTG; odwrócona cyklofilina, TGTCTTTGGAACTTTGTCTGCAA
[więcej w: łysoń sklep, sklep pszczelarski łysoń, wrzodziejące zapalenie jelita grubego dieta ]
[przypisy: sprzęt pszczelarski łysoń, centrum pszczelarskie łysoń, sklep pszczelarski łysoń ]