Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego

Syntaza prostacykliny (PGIS) jest ostatnim zaangażowanym enzymem w szlaku metabolicznym prowadzącym do produkcji prostacykliny (PGI2). Pacjenci z ciężkim nadciśnieniem płucnym mają niedobór PGIS ich naczyń przedkapilarnych, ale znaczenie tego niedoboru dla przebudowy naczyń płucnych pozostaje niejasne. Postawiliśmy hipotezę, że selektywna nadmierna ekspresja PGIS w płucach może zapobiegać rozwojowi nadciśnienia płucnego. W celu zbadania tej hipotezy, transgeniczne myszy wytworzono z wybiórczą nadekspresją płucnego PGIS, stosując konstrukt promotora ludzkiego białka powierzchniowo czynnego 3,7 kb (SP-C) i szczurzego cDNA PGIS. Transgeniczne myszy (Tg +) i nietransgeniczne mioty z rodziny miot (Tg.) Poddano symulowanej wysokości 17 000 stóp przez 5 tygodni i zmierzono ciśnienie skurczowe prawej komory (RVSP). Read more „Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7

Wydaje się jednak, że wydzielana forma nie jest odpowiednio eksponowana na jej substrat w świetle jelita, ponieważ CSID został oceniony przy użyciu testu oddechowego wodoru. Jest to prawdopodobnie wynikiem krótkiego okresu półtrwania wydzielanej postaci. Wytwarzanie wydzielonej hydrofilowej postaci SI zachodzi poprzez eliminację swojej domeny zakotwiczającej w błonie, która służy również jako sekwencja sygnałowa w glikoproteinie błonowej tego typu II. Udało nam się scharakteryzować podstawy molekularne tego cięcia, które jest punktową mutacją nukleotydu 1021, która powoduje substytucję leucyny i proliny przy reszcie aminokwasowej 340 podjednostki izomaltazy. Ta mutacja jest rzeczywiście odpowiedzialna za ten fenotyp, ponieważ wprowadzenie L340P do dzikiego typu pro-SI w transfekowanej linii komórkowej ssaka generuje efekty podobne do obserwowanych w tkance jelitowej. Read more „Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7”

Zachowanie wysokoenergetycznych fosforanów mięśnia sercowego podczas niedokrwienia o małym natężeniu przepływu z modyfikacją powinowactwa hemoglobiny do tlenu ad 7

Jednakże negatywne efekty inotropowe, hipertoniczność i glikolityczne substraty roztworu zostały również uznane za potencjalne czynniki przyczyniające się do ochrony przed niedokrwieniem. Klofibrat był jednym z pierwszych syntetycznych związków uznanych za powodujące przesunięcie w prawo krzywej Hb A O2 (14), a inne zostały przebadane w eksperymentalnym niedokrwieniu mięśnia sercowego. Wpływ benzoesanu sodu orto-jodo (OISB), pochodnej kwasu benzoesowego, która zmniejsza powinowactwo hemoglobiny do tlenu niezależnego od DPG (32), w przypadku uszkodzenia niedokrwiennego badano w izolowanych i nienaruszonych sercach psich. Wewnątrzrodzeniowy wlew OISB w izolowanych psich sercach zwiększył zatoki wieńcowe p50 i pO2 oraz zmniejszył tętno i skurczowe ciśnienie lewej komory (32). Podczas tempie, niedokrwienia o niskim przepływie w tym samym modelu, OISB (200 mg / min) zwiększyło p50 (. Read more „Zachowanie wysokoenergetycznych fosforanów mięśnia sercowego podczas niedokrwienia o małym natężeniu przepływu z modyfikacją powinowactwa hemoglobiny do tlenu ad 7”

Enteroagregacyjna Escherichia coli wyraża nową flagelinę, która powoduje uwalnianie IL-8 z komórek nabłonka jelitowego ad 6

Ścieżka zawierająca 2,5 gramy wici EAEC 042 (A) została włączona do żelu jako kontrola. W celu uwolnienia IL-8 oczyszczoną wici (72 ng) lub lizat bakteryjny (1 ug) dodano do 500 ul do studzienek komórek Caco-2 w tym samym eksperymencie, a supernatant oznaczono po 3 godzinach inkubacji. (b) BL21 (DE3) pLysS: pfliC zebrano 2 godziny po dodaniu IPTG do hodowli w połowie fazy log. Lizaty oczyszczono przez chromatografię powinowactwa na niklu, wizualizowano na żelach 9% SDS-PAGE i przeniesiono na membranę PVDF, którą sondowano Ni2 + -HRP. Ścieżka 1: wici EAEC 042, 1,4 g. Read more „Enteroagregacyjna Escherichia coli wyraża nową flagelinę, która powoduje uwalnianie IL-8 z komórek nabłonka jelitowego ad 6”

Receptor wykrywający wapń jest wymagany do prawidłowej homeostazy wapnia, niezależnie od hormonu przytarczyc ad 6

Porównano kości z miotów z niedoborem CaR i miotami z ekspresją CaR (wszystkie Pth A / b) utrzymywane na diecie wysokobiałkowej. Analiza histologiczna odcinków kości udowej i piszczelowej z Pth. /. CaR. /. Read more „Receptor wykrywający wapń jest wymagany do prawidłowej homeostazy wapnia, niezależnie od hormonu przytarczyc ad 6”

Długotrwałe utrzymywanie się jąder dawców u pacjentów z dystrofią mięśniową Duchennea otrzymujących przeszczep szpiku kostnego ad 5

Po zbadaniu, klastery miofibrów dodatnich pod względem dystrofiny obserwowano u wszystkich pacjentów, bez widocznej różnicy między skrawkami z DMD-BMT1 i nieransplantowaną pacjentką DMD Dl (Figura 3, d. F) i D2 (dane nie pokazany). Skrawki zabarwione MANDYS102 rozpoznające epitop białka w eksonie dystrofiny 43 (43, 44) (Figura 3, a i d) lub CAP6-10 rozpoznające epitopy białkowe w eksonach dystrofiny 42. 64 (38) (Figura 3, c i f) ujawnione słaba reaktywność dystrofiny w większości mięśniaków i silna reaktywność w zdyspergowanych, zgrupowanych miowłókienkach, które również wydawały się dodatnie z MANEX46B, Ab specyficznym dla epitopu białka w egzonie 46 dystrofiny 46 (Figura 3, b i e). Nie stwierdzono wykrywalnej różnicy w wybarwieniu dystrofiny pomiędzy nieransplantowanymi kontrolami a DMD-BMT1. Read more „Długotrwałe utrzymywanie się jąder dawców u pacjentów z dystrofią mięśniową Duchennea otrzymujących przeszczep szpiku kostnego ad 5”

Sumoilated HSP90 jest dominującym czynnikiem dziedziczącym ryzyko dyssypcji komórek plazmatycznych ad 5

Sumoilowane białka biorą udział w różnych procesach komórkowych, w tym stabilności białka, odpowiedzi lub stresie, odpowiedzi na uszkodzenie DNA, transport jądrowo-cytoplazmatyczny, regulację transkrypcji, wzrost komórek, przeżycie i apoptozę (11, 14, 15). Sumoilowane autoantygeny opisano jako nową i niezależną klasę autoantygenów w pierwotnej marskości żółciowej (16). Nie ustalono, czy trwała sumoilacja HSP90 ma konsekwencje funkcjonalne w poszczególnych nośnikach. Jednakże, ponieważ WT HSP90 jest wciąż obecny na odpowiednim poziomie w odpowiednich komórkach w nośnikach HSP90-SUMO1, zakładalibyśmy, że obecność HSP90-SUMO1 nie powinna skutkować dużymi zmianami funkcjonalnymi komórek koeksprymujących WT HSP90 i HSP90-SUMO1. Należy jednak pamiętać, że cząsteczka HSP90 WT jest dimerem, a każdy protomer można podzielić na strukturalnie i funkcjonalnie odrębne domeny. Read more „Sumoilated HSP90 jest dominującym czynnikiem dziedziczącym ryzyko dyssypcji komórek plazmatycznych ad 5”

Nowe role śródbłonka limfatycznego w regulowaniu odporności adaptacyjnej ad 5

Jednak zdolność komórek niehematopoetycznych do indukowania obwodowej tolerancji komórek T CD8 + nie jest unikalna dla LEC i FRC. Komórki śródbłonka wątroby sinusoidalne (LSEC) są uważane za krytyczne pod względem tolerancji na antygeny pokarmowe, ponieważ montują tolerancję delecyjną CD8 + wobec egzogennych antygenów pochodzących bezpośrednio z jelit (68, 69). Indukcja tolerancji przez komórki zrębu przypomina centralną tolerancję wywołaną w grasicy przez zrębowe komórki nabłonka grasicy (mTEC), proces zależny od ekspresji PTA napędzanej przez autoimmunologiczny regulator Aire (70). Ze względu na podobieństwa między LNSC i mTEC badano zależność Aire w indukowanej przez LNSC tolerancji limfocytów T CD8 +. Przy użyciu PTA eksprymowanego pod promotorem Aire, komórki zewnątrz ekspresji Aire (eTAC) były zaangażowane w indukowanie tolerancji komórek T CD8 + w SLO (71). Read more „Nowe role śródbłonka limfatycznego w regulowaniu odporności adaptacyjnej ad 5”