Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7

Wydaje się jednak, że wydzielana forma nie jest odpowiednio eksponowana na jej substrat w świetle jelita, ponieważ CSID został oceniony przy użyciu testu oddechowego wodoru. Jest to prawdopodobnie wynikiem krótkiego okresu półtrwania wydzielanej postaci. Wytwarzanie wydzielonej hydrofilowej postaci SI zachodzi poprzez eliminację swojej domeny zakotwiczającej w błonie, która służy również jako sekwencja sygnałowa w glikoproteinie błonowej tego typu II. Udało nam się scharakteryzować podstawy molekularne tego cięcia, które jest punktową mutacją nukleotydu 1021, która powoduje substytucję leucyny i proliny przy reszcie aminokwasowej 340 podjednostki izomaltazy. Ta mutacja jest rzeczywiście odpowiedzialna za ten fenotyp, ponieważ wprowadzenie L340P do dzikiego typu pro-SI w transfekowanej linii komórkowej ssaka generuje efekty podobne do obserwowanych w tkance jelitowej. Read more „Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego

Syntaza prostacykliny (PGIS) jest ostatnim zaangażowanym enzymem w szlaku metabolicznym prowadzącym do produkcji prostacykliny (PGI2). Pacjenci z ciężkim nadciśnieniem płucnym mają niedobór PGIS ich naczyń przedkapilarnych, ale znaczenie tego niedoboru dla przebudowy naczyń płucnych pozostaje niejasne. Postawiliśmy hipotezę, że selektywna nadmierna ekspresja PGIS w płucach może zapobiegać rozwojowi nadciśnienia płucnego. W celu zbadania tej hipotezy, transgeniczne myszy wytworzono z wybiórczą nadekspresją płucnego PGIS, stosując konstrukt promotora ludzkiego białka powierzchniowo czynnego 3,7 kb (SP-C) i szczurzego cDNA PGIS. Transgeniczne myszy (Tg +) i nietransgeniczne mioty z rodziny miot (Tg.) Poddano symulowanej wysokości 17 000 stóp przez 5 tygodni i zmierzono ciśnienie skurczowe prawej komory (RVSP). Read more „Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego”