Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7

Barwienie H & E na skrawkach tkanek zamkniętych przeprowadzono zgodnie ze standardową procedurą. Komórki przechodzące apoptozę wykryto przy użyciu zmodyfikowanej metody TUNEL w ośrodku immunohistochemicznym na Uniwersytecie w Chicago. Pokrótce, sekcje śledziony inkubowano z 2 mM sprzężonym z digoksygeniną dUTP (Chemicon Inc.) i 5 U końcowej transferazy dezoksyrybonukleotydowej (TdT) w buforze TdT (0,5 M kakodylanu [pH 6,8], mM CaCl2, 0,5 mM DTT, 0,05 % BSA, 0,15 M NaCl). Po płukaniu w soli fizjologicznej buforowanej Tris sekcje inkubowano z przeciwciałem anty-owczym Ig sprzężonym z HRP (Jackson ImmunoResearch Laboratories Inc.). Rozwój barwy dla związanego HRP był z 3-amino-9-etylokarbazolem (Sigma-Aldrich). Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7

Wydaje się jednak, że wydzielana forma nie jest odpowiednio eksponowana na jej substrat w świetle jelita, ponieważ CSID został oceniony przy użyciu testu oddechowego wodoru. Jest to prawdopodobnie wynikiem krótkiego okresu półtrwania wydzielanej postaci. Wytwarzanie wydzielonej hydrofilowej postaci SI zachodzi poprzez eliminację swojej domeny zakotwiczającej w błonie, która służy również jako sekwencja sygnałowa w glikoproteinie błonowej tego typu II. Udało nam się scharakteryzować podstawy molekularne tego cięcia, które jest punktową mutacją nukleotydu 1021, która powoduje substytucję leucyny i proliny przy reszcie aminokwasowej 340 podjednostki izomaltazy. Ta mutacja jest rzeczywiście odpowiedzialna za ten fenotyp, ponieważ wprowadzenie L340P do dzikiego typu pro-SI w transfekowanej linii komórkowej ssaka generuje efekty podobne do obserwowanych w tkance jelitowej. Read more „Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7”

Zachowanie wysokoenergetycznych fosforanów mięśnia sercowego podczas niedokrwienia o małym natężeniu przepływu z modyfikacją powinowactwa hemoglobiny do tlenu ad 6

Podczas zmniejszania przepływu krwi przez LAD występowała regionalna dysfunkcja ze wzrostem wymiarów rozkurczowych i końcowo-skurczowych, przesunięcie w prawo pętli wymiaru ciśnienia i relacji oraz redukcja frakcyjnego skracania i pracy regionalnej. Nie było żadnych znaczących zmian na terytorium okalającym (ryc. 9b). Dziesięć minut po podaniu dożylnego RSR13 z niezmienionym ciśnieniem perfuzji wieńcowej nastąpiła znaczna poprawa funkcji, o czym świadczyło częściowo przesunięcie krzywych ciśnienia o wymiar w lewo na niższe wymiary skurczowe i końcoworozkurczowe (ryc. 9a). Read more „Zachowanie wysokoenergetycznych fosforanów mięśnia sercowego podczas niedokrwienia o małym natężeniu przepływu z modyfikacją powinowactwa hemoglobiny do tlenu ad 6”

Enteroagregacyjna Escherichia coli wyraża nową flagelinę, która powoduje uwalnianie IL-8 z komórek nabłonka jelitowego ad 6

Ścieżka zawierająca 2,5 gramy wici EAEC 042 (A) została włączona do żelu jako kontrola. W celu uwolnienia IL-8 oczyszczoną wici (72 ng) lub lizat bakteryjny (1 ug) dodano do 500 ul do studzienek komórek Caco-2 w tym samym eksperymencie, a supernatant oznaczono po 3 godzinach inkubacji. (b) BL21 (DE3) pLysS: pfliC zebrano 2 godziny po dodaniu IPTG do hodowli w połowie fazy log. Lizaty oczyszczono przez chromatografię powinowactwa na niklu, wizualizowano na żelach 9% SDS-PAGE i przeniesiono na membranę PVDF, którą sondowano Ni2 + -HRP. Ścieżka 1: wici EAEC 042, 1,4 g. Read more „Enteroagregacyjna Escherichia coli wyraża nową flagelinę, która powoduje uwalnianie IL-8 z komórek nabłonka jelitowego ad 6”

Receptor wykrywający wapń jest wymagany do prawidłowej homeostazy wapnia, niezależnie od hormonu przytarczyc ad 6

Porównano kości z miotów z niedoborem CaR i miotami z ekspresją CaR (wszystkie Pth A / b) utrzymywane na diecie wysokobiałkowej. Analiza histologiczna odcinków kości udowej i piszczelowej z Pth. /. CaR. /. Read more „Receptor wykrywający wapń jest wymagany do prawidłowej homeostazy wapnia, niezależnie od hormonu przytarczyc ad 6”

Pdx1 przywraca funkcja komórek w myszach z nokautem Irs2 ad 5

Testy tolerancji glukozy u myszy w wieku 12 do 13 tygodni przeprowadzone z użyciem 2 g D-glukozy na kg masy ciała po 15 do 16-godzinnym poście. Wyniki zgłaszane jako średnie. SEM dla co najmniej ośmiu zwierząt na genotyp. * P <0,05 vs. typ dziki; ** P <0,01 vs. Read more „Pdx1 przywraca funkcja komórek w myszach z nokautem Irs2 ad 5”

Długotrwałe utrzymywanie się jąder dawców u pacjentów z dystrofią mięśniową Duchennea otrzymujących przeszczep szpiku kostnego ad 5

Po zbadaniu, klastery miofibrów dodatnich pod względem dystrofiny obserwowano u wszystkich pacjentów, bez widocznej różnicy między skrawkami z DMD-BMT1 i nieransplantowaną pacjentką DMD Dl (Figura 3, d. F) i D2 (dane nie pokazany). Skrawki zabarwione MANDYS102 rozpoznające epitop białka w eksonie dystrofiny 43 (43, 44) (Figura 3, a i d) lub CAP6-10 rozpoznające epitopy białkowe w eksonach dystrofiny 42. 64 (38) (Figura 3, c i f) ujawnione słaba reaktywność dystrofiny w większości mięśniaków i silna reaktywność w zdyspergowanych, zgrupowanych miowłókienkach, które również wydawały się dodatnie z MANEX46B, Ab specyficznym dla epitopu białka w egzonie 46 dystrofiny 46 (Figura 3, b i e). Nie stwierdzono wykrywalnej różnicy w wybarwieniu dystrofiny pomiędzy nieransplantowanymi kontrolami a DMD-BMT1. Read more „Długotrwałe utrzymywanie się jąder dawców u pacjentów z dystrofią mięśniową Duchennea otrzymujących przeszczep szpiku kostnego ad 5”

Sumoilated HSP90 jest dominującym czynnikiem dziedziczącym ryzyko dyssypcji komórek plazmatycznych ad 5

Sumoilowane białka biorą udział w różnych procesach komórkowych, w tym stabilności białka, odpowiedzi lub stresie, odpowiedzi na uszkodzenie DNA, transport jądrowo-cytoplazmatyczny, regulację transkrypcji, wzrost komórek, przeżycie i apoptozę (11, 14, 15). Sumoilowane autoantygeny opisano jako nową i niezależną klasę autoantygenów w pierwotnej marskości żółciowej (16). Nie ustalono, czy trwała sumoilacja HSP90 ma konsekwencje funkcjonalne w poszczególnych nośnikach. Jednakże, ponieważ WT HSP90 jest wciąż obecny na odpowiednim poziomie w odpowiednich komórkach w nośnikach HSP90-SUMO1, zakładalibyśmy, że obecność HSP90-SUMO1 nie powinna skutkować dużymi zmianami funkcjonalnymi komórek koeksprymujących WT HSP90 i HSP90-SUMO1. Należy jednak pamiętać, że cząsteczka HSP90 WT jest dimerem, a każdy protomer można podzielić na strukturalnie i funkcjonalnie odrębne domeny. Read more „Sumoilated HSP90 jest dominującym czynnikiem dziedziczącym ryzyko dyssypcji komórek plazmatycznych ad 5”

Nowe role śródbłonka limfatycznego w regulowaniu odporności adaptacyjnej czesc 4

U tych myszy migracja DC do LN opróżniających skórę pleców wydawała się normalna pomimo poważnego upośledzenia drenażu limfatycznego, co wskazuje, że gęstość limfocytarna reguluje raczej przepływ płynu i antygen niż migrację DC (52). Ma to wpływ na zrozumienie roli miejscowej limfangiogenezy, w której naczynia limfatyczne rozszerzają się i stają się hiperplastyczne, co występuje w przewlekłym zapaleniu. Tak więc, LEC aktywnie regulują przemyt leukocytów przez modulowanie ekspresji chemokin i cząsteczek adhezyjnych zgodnie z lokalnym stanem zapalenia w tkance. LEC mogą integrować wiele sygnałów, w tym produkty aktywacji dopełniacza i zwiększony przepływ, jak również większość sygnałów niebezpieczeństwa, za pośrednictwem sygnalizacji TLR (Tabela 2), pozwalając im modulować różnicową regulację transportu leukocytów lub dostarczania antygenów i lokalnych cytokin tkankowych (17). LEC regulują wejście komórek odpornościowych do LN. Read more „Nowe role śródbłonka limfatycznego w regulowaniu odporności adaptacyjnej czesc 4”