Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7

Wydaje się jednak, że wydzielana forma nie jest odpowiednio eksponowana na jej substrat w świetle jelita, ponieważ CSID został oceniony przy użyciu testu oddechowego wodoru. Jest to prawdopodobnie wynikiem krótkiego okresu półtrwania wydzielanej postaci. Wytwarzanie wydzielonej hydrofilowej postaci SI zachodzi poprzez eliminację swojej domeny zakotwiczającej w błonie, która służy również jako sekwencja sygnałowa w glikoproteinie błonowej tego typu II. Udało nam się scharakteryzować podstawy molekularne tego cięcia, które jest punktową mutacją nukleotydu 1021, która powoduje substytucję leucyny i proliny przy reszcie aminokwasowej 340 podjednostki izomaltazy. Ta mutacja jest rzeczywiście odpowiedzialna za ten fenotyp, ponieważ wprowadzenie L340P do dzikiego typu pro-SI w transfekowanej linii komórkowej ssaka generuje efekty podobne do obserwowanych w tkance jelitowej. Read more „Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 7”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7

Barwienie H & E na skrawkach tkanek zamkniętych przeprowadzono zgodnie ze standardową procedurą. Komórki przechodzące apoptozę wykryto przy użyciu zmodyfikowanej metody TUNEL w ośrodku immunohistochemicznym na Uniwersytecie w Chicago. Pokrótce, sekcje śledziony inkubowano z 2 mM sprzężonym z digoksygeniną dUTP (Chemicon Inc.) i 5 U końcowej transferazy dezoksyrybonukleotydowej (TdT) w buforze TdT (0,5 M kakodylanu [pH 6,8], mM CaCl2, 0,5 mM DTT, 0,05 % BSA, 0,15 M NaCl). Po płukaniu w soli fizjologicznej buforowanej Tris sekcje inkubowano z przeciwciałem anty-owczym Ig sprzężonym z HRP (Jackson ImmunoResearch Laboratories Inc.). Rozwój barwy dla związanego HRP był z 3-amino-9-etylokarbazolem (Sigma-Aldrich). Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7”