Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 6

Lizę przeprowadzono w obecności TX-114. SI poddano immunoprecypitacji z fazy wodnej (S) i detergentowej (P), potraktowano Endo H i analizowano za pomocą SDS-PAGE na żelu 6% w żelu, a następnie fluorografia. Dodatkowy prążek pojawiający się w próbkach L340P w aib jest wskazywany przez groty strzałek. W świetle danych z analizy impulsów widać, że skrócona forma pro-SI była prekursorem wydzielanych gatunków i jako taka była również białkiem hydrofilowym. Aby to potwierdzić, zbadaliśmy zdolność do ekstrakcji detergentem w TX-114 postaci pro-SI z tkanki pacjenta i kontrolnej. Read more „Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 6”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego ad 7

Pomimo jedynie 2-krotnego wzrostu aktywności PGIS, myszy eksprymujące PGIS narażone na przewlekłe niedotlenienie nie wykazały żadnych dowodów na nadciśnienie płucne i miały RVSP, który był o 60% niższy niż u ich nietransgenicznych matek. RVSP dla transgenicznych zwierząt nie zmieniła się od linii podstawowej po 5 tygodniach przewlekłego niedotlenienia. Ponadto, grubość ścianek naczyń od małych do średnich tętnic była około jedna trzecia cieńsza u myszy z ekspresją PGIS po przewlekłym niedotlenieniu i była nie do odróżnienia od myszy kontrolnych o małej wysokości, wykazując, że nie nastąpiła przebudowa naczyń u transgenicznych zwierząt. Efekt dozowania genów może być obecny, chociaż nasza linia o niższej ekspresji (linia 7), z 47% wzrostem 6-keto PGF1. produkcji, nie był chroniony przed rozwojem nadciśnienia płucnego po ekspozycji na przewlekłe niedotlenienie. Read more „Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego ad 7”

Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7

Barwienie H & E na skrawkach tkanek zamkniętych przeprowadzono zgodnie ze standardową procedurą. Komórki przechodzące apoptozę wykryto przy użyciu zmodyfikowanej metody TUNEL w ośrodku immunohistochemicznym na Uniwersytecie w Chicago. Pokrótce, sekcje śledziony inkubowano z 2 mM sprzężonym z digoksygeniną dUTP (Chemicon Inc.) i 5 U końcowej transferazy dezoksyrybonukleotydowej (TdT) w buforze TdT (0,5 M kakodylanu [pH 6,8], mM CaCl2, 0,5 mM DTT, 0,05 % BSA, 0,15 M NaCl). Po płukaniu w soli fizjologicznej buforowanej Tris sekcje inkubowano z przeciwciałem anty-owczym Ig sprzężonym z HRP (Jackson ImmunoResearch Laboratories Inc.). Rozwój barwy dla związanego HRP był z 3-amino-9-etylokarbazolem (Sigma-Aldrich). Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7”