Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego ad 7

Pomimo jedynie 2-krotnego wzrostu aktywności PGIS, myszy eksprymujące PGIS narażone na przewlekłe niedotlenienie nie wykazały żadnych dowodów na nadciśnienie płucne i miały RVSP, który był o 60% niższy niż u ich nietransgenicznych matek. RVSP dla transgenicznych zwierząt nie zmieniła się od linii podstawowej po 5 tygodniach przewlekłego niedotlenienia. Ponadto, grubość ścianek naczyń od małych do średnich tętnic była około jedna trzecia cieńsza u myszy z ekspresją PGIS po przewlekłym niedotlenieniu i była nie do odróżnienia od myszy kontrolnych o małej wysokości, wykazując, że nie nastąpiła przebudowa naczyń u transgenicznych zwierząt. Efekt dozowania genów może być obecny, chociaż nasza linia o niższej ekspresji (linia 7), z 47% wzrostem 6-keto PGF1. produkcji, nie był chroniony przed rozwojem nadciśnienia płucnego po ekspozycji na przewlekłe niedotlenienie. Read more „Nadekspresja syntazy prostacyklinowej u myszy transgenicznych chroni przed rozwojem hipoksycznego nadciśnienia płucnego ad 7”

Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7

Barwienie H & E na skrawkach tkanek zamkniętych przeprowadzono zgodnie ze standardową procedurą. Komórki przechodzące apoptozę wykryto przy użyciu zmodyfikowanej metody TUNEL w ośrodku immunohistochemicznym na Uniwersytecie w Chicago. Pokrótce, sekcje śledziony inkubowano z 2 mM sprzężonym z digoksygeniną dUTP (Chemicon Inc.) i 5 U końcowej transferazy dezoksyrybonukleotydowej (TdT) w buforze TdT (0,5 M kakodylanu [pH 6,8], mM CaCl2, 0,5 mM DTT, 0,05 % BSA, 0,15 M NaCl). Po płukaniu w soli fizjologicznej buforowanej Tris sekcje inkubowano z przeciwciałem anty-owczym Ig sprzężonym z HRP (Jackson ImmunoResearch Laboratories Inc.). Rozwój barwy dla związanego HRP był z 3-amino-9-etylokarbazolem (Sigma-Aldrich). Read more „Rola mediatora wnikania wirusa opryszczki jako negatywnego regulatora odpowiedzi pośredniczonych przez limfocyty T ad 7”

Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7

Sekwencję kodującą gen RAG1 amplifikowano przez PCR z genomowego DNA uzyskanego z pełnej krwi przy użyciu 1F7b: CTGGATCCTTATAAGATACATCAGTGGG; 1092R: CGGCAAGAGGGACAAT; 1052F: CGGGTCTGCATTCTCAG; 2089R: CTCATCTGCCAGCATAAGG; 2013F: TTGCCCACAGCTCTCAGAAT; 2594R: CCTGCCACCTTTTCCTTTC; 2401F: GCGTTCCAACCCTTACC; 3324R: Startery GCCCCATACAGCAGTA i Expand High Fidelity PCR System (Roche Diagnostics Corp.) zgodnie z zaleceniami producenta. Startery nukleotydowe zaprojektowano w oparciu o sekwencję HuRAG1 uzyskaną przez Schatz i współpracowników (50). Analiza PCR V. -C. i V. Read more „Nowatorski niedobór odporności związany z hipomorficznymi mutacjami RAG1 i zakażeniem CMV ad 7”

Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 6

Lizę przeprowadzono w obecności TX-114. SI poddano immunoprecypitacji z fazy wodnej (S) i detergentowej (P), potraktowano Endo H i analizowano za pomocą SDS-PAGE na żelu 6% w żelu, a następnie fluorografia. Dodatkowy prążek pojawiający się w próbkach L340P w aib jest wskazywany przez groty strzałek. W świetle danych z analizy impulsów widać, że skrócona forma pro-SI była prekursorem wydzielanych gatunków i jako taka była również białkiem hydrofilowym. Aby to potwierdzić, zbadaliśmy zdolność do ekstrakcji detergentem w TX-114 postaci pro-SI z tkanki pacjenta i kontrolnej. Read more „Wrodzony niedobór sucrase-izomaltazy powstały w wyniku cięcia i wydzielania zmutowanej postaci enzymu ad 6”

Zachowanie wysokoenergetycznych fosforanów mięśnia sercowego podczas niedokrwienia o małym natężeniu przepływu z modyfikacją powinowactwa hemoglobiny do tlenu ad 6

Podczas zmniejszania przepływu krwi przez LAD występowała regionalna dysfunkcja ze wzrostem wymiarów rozkurczowych i końcowo-skurczowych, przesunięcie w prawo pętli wymiaru ciśnienia i relacji oraz redukcja frakcyjnego skracania i pracy regionalnej. Nie było żadnych znaczących zmian na terytorium okalającym (ryc. 9b). Dziesięć minut po podaniu dożylnego RSR13 z niezmienionym ciśnieniem perfuzji wieńcowej nastąpiła znaczna poprawa funkcji, o czym świadczyło częściowo przesunięcie krzywych ciśnienia o wymiar w lewo na niższe wymiary skurczowe i końcoworozkurczowe (ryc. 9a). Read more „Zachowanie wysokoenergetycznych fosforanów mięśnia sercowego podczas niedokrwienia o małym natężeniu przepływu z modyfikacją powinowactwa hemoglobiny do tlenu ad 6”

Enteroagregacyjna Escherichia coli wyraża nową flagelinę, która powoduje uwalnianie IL-8 z komórek nabłonka jelitowego ad 6

Ścieżka zawierająca 2,5 gramy wici EAEC 042 (A) została włączona do żelu jako kontrola. W celu uwolnienia IL-8 oczyszczoną wici (72 ng) lub lizat bakteryjny (1 ug) dodano do 500 ul do studzienek komórek Caco-2 w tym samym eksperymencie, a supernatant oznaczono po 3 godzinach inkubacji. (b) BL21 (DE3) pLysS: pfliC zebrano 2 godziny po dodaniu IPTG do hodowli w połowie fazy log. Lizaty oczyszczono przez chromatografię powinowactwa na niklu, wizualizowano na żelach 9% SDS-PAGE i przeniesiono na membranę PVDF, którą sondowano Ni2 + -HRP. Ścieżka 1: wici EAEC 042, 1,4 g. Read more „Enteroagregacyjna Escherichia coli wyraża nową flagelinę, która powoduje uwalnianie IL-8 z komórek nabłonka jelitowego ad 6”

Pdx1 przywraca funkcja komórek w myszach z nokautem Irs2 ad 5

Testy tolerancji glukozy u myszy w wieku 12 do 13 tygodni przeprowadzone z użyciem 2 g D-glukozy na kg masy ciała po 15 do 16-godzinnym poście. Wyniki zgłaszane jako średnie. SEM dla co najmniej ośmiu zwierząt na genotyp. * P <0,05 vs. typ dziki; ** P <0,01 vs. Read more „Pdx1 przywraca funkcja komórek w myszach z nokautem Irs2 ad 5”

Długotrwałe utrzymywanie się jąder dawców u pacjentów z dystrofią mięśniową Duchennea otrzymujących przeszczep szpiku kostnego ad 5

Po zbadaniu, klastery miofibrów dodatnich pod względem dystrofiny obserwowano u wszystkich pacjentów, bez widocznej różnicy między skrawkami z DMD-BMT1 i nieransplantowaną pacjentką DMD Dl (Figura 3, d. F) i D2 (dane nie pokazany). Skrawki zabarwione MANDYS102 rozpoznające epitop białka w eksonie dystrofiny 43 (43, 44) (Figura 3, a i d) lub CAP6-10 rozpoznające epitopy białkowe w eksonach dystrofiny 42. 64 (38) (Figura 3, c i f) ujawnione słaba reaktywność dystrofiny w większości mięśniaków i silna reaktywność w zdyspergowanych, zgrupowanych miowłókienkach, które również wydawały się dodatnie z MANEX46B, Ab specyficznym dla epitopu białka w egzonie 46 dystrofiny 46 (Figura 3, b i e). Nie stwierdzono wykrywalnej różnicy w wybarwieniu dystrofiny pomiędzy nieransplantowanymi kontrolami a DMD-BMT1. Read more „Długotrwałe utrzymywanie się jąder dawców u pacjentów z dystrofią mięśniową Duchennea otrzymujących przeszczep szpiku kostnego ad 5”

Sumoilated HSP90 jest dominującym czynnikiem dziedziczącym ryzyko dyssypcji komórek plazmatycznych czesc 4

Desumoilacja HSP90-SUMO1. LCL pochodzące od zdrowego dawcy (po lewej) lub od pacjenta (po prawej) i transformowane shRNA swoistymi dla poszczególnych SENP sprawdzano pod względem HSP90 metodą Western blot i immunodetekcję z użyciem mAb anty-HSP90. HSP90-SUMO1 był wykrywalny tylko wtedy, gdy SENP2 był zahamowany. Ścieżka 1: inkubacja z zaszyfrowanym shRNA; ścieżki 2. 5: inkubacja z shRNA versus SENP1 (linia 2), SENP2 (linia 3), SENP3 (linia 4) i SENP5 (linia 5). Read more „Sumoilated HSP90 jest dominującym czynnikiem dziedziczącym ryzyko dyssypcji komórek plazmatycznych czesc 4”