Trostostymina, heterodimer dwóch nowych ludzkich podjednostek hormonu glikoproteinowego, aktywuje receptor hormonu tarczycy ad

Specyficzne interakcje różnych par białek oceniano na podstawie aktywacji genu reporterowego GAL1-HIS3 w pożywce pozbawionej leucyny, tryptofanu i histydyny, ale w obecności 5 mM 3-aminotriazolu (13). Badano co najmniej 10 różnych kolonii wyrażających każdą parę białek fuzyjnych. Do analizy RT-PCR ekspresji mRNA A2 i B5, tkanki zebrano od 50-dniowych samców szczura Sprague-Dawley (Simonsen Laboratories Inc., Gilroy, California, USA). Całkowity mRNA ekstrahowano za pomocą odczynnika TRIzol (Life Technologies Inc., Grand Island, Nowy Jork, USA) przed RT uzyskując cDNA. Amplifikację PCR cDNA przeprowadzono w warunkach wysokiej ostrości (denaturacja: 94 ° C, 30 sekund, hybrydyzacja i wydłużanie: 68. 72 ° C, 3 minuty, 35 cykli). Konkretnymi starterami są: starter poprzedzający A2, CATCCCAGGCTGCCACTTGCACCCCTTC; A2 starterowy primer, CTTTCTGAGGCTGCTGATGGTGCAGC; Primer B5 w górę rzeki, ATGGCCCTCCTCCTTCTGGCTGGCTAT; B5 dalszy starter, CTCCGCAGTCACAGCGGATGGCCACGG. Pominięcie etapu RT prowadziło do utraty produktów PCR. Generacja Ab do A2 i B5 oraz immunoanalizy. W celu wytworzenia Ab, cDNA odpowiadające dojrzałemu regionowi ludzkiego A2 lub B5 subklonowano do wektora pGEX-4T-1 (Amersham Pharmacia Biotech, Piscataway, New Jersey, USA). Po transformacji do szczepu BL21 Escherichia coli (Invitrogen Corp., Carlsbad, California, USA), indukowano ekspresję białek fuzyjnych składających się z transferazy S-glutationu i dojrzałego A2 lub B5 po leczeniu izopropylo-1-tio-A-D- galaktozyd. Białka fuzyjne w lizacie bakteryjnym oczyszczono przy użyciu kolumny powinowactwa glutation-Sepharose 4B, zemulgowanej w adiuwancie Freunda i wstrzyknięto do królika (Strategic BioSolutions Inc., Newark, Delaware, USA) w celu uzyskania pokolenia Ab. IgG oczyszczono przy użyciu kolumny Protein G Sepharose 4 Fast Flow (Amersham Pharmacia Biotech). W celu wytworzenia dimerów A2 / B5 komórki nerki ludzkiego nerka płodu 293T transfekowano cDNA podjednostek A2 i B5 subklonowanych do wektora bipromoterowego pBudCE4.1 (Invitrogen Corp.), stosując metodę precypitacji fosforanem wapnia. Pożywne kondycjonowane pożywki zawierające rekombinowane białka zebrano i zatężono 200-krotnie stosując membrany Ultrafree 10-kb. Pożywki gotowano w buforze do próbek SDS przez 5 minut i poddano 12% SDS-PAGE z Tricine. W przypadku immunoblottingu błonę blokowano w 5% beztłuszczowym mleku w proszku w roztworze buforowym Tris z 0,1% Tween 20 przez godzinę, a następnie inkubowano z poliklonalnym Ab skierowanym przeciw króliczym A2 lub B5 przez godzinę w temperaturze pokojowej. Następnie blot inkubowano przez 30 minut z 0,1 .g / ml koniugatu peroksydazy chrzanowej przeciw króliczej IgG-IgG (Promega Corp., Madison, Wisconsin, USA) jako drugorzędowego Ab przed wizualizacją przez wzmocnioną chemiluminescencję (Amersham Pharmacia Biotech). Podobne testy immunoblotowe przeprowadzono również przy użyciu ekstraktów przedniego płata przysadki uzyskanych od dorosłych samców szczurów. W celu barwienia immunologicznego, przednią przysadkę od dorosłych samców szczurów osadzono w parafinie po utrwaleniu w roztworze Bouina. Skrawki tkanki były blokowane 5% surowicą kozią w PBS przez 30 minut, aby wysycić niespecyficzne miejsca wiązania. Pierwotne królicze poliklonalne Ab do A2 lub B5 rozcieńczono do 1: 200 w PBS zawierającym 5% surowicy koziej. Skrawki inkubowano przez noc w 4 ° C i płukano trzy razy po 20 minut w PBS. Skrawki następnie inkubowano ze skoniugowanym ze złotem kozim anty-króliczym drugorzędowym Ab, po czym barwienie roztworem SilvEnhance (Zymed Laboratories Inc., South San Francisco, Kalifornia, USA), jak opisano wcześniej (14). Kontrole negatywne przeprowadzono przez podstawienie pierwszorzędowego Ab króliczą surowicą odpornościową. W analizie immunohistochemicznej przy użyciu podwójnego znakowania fluorescencyjnego (15), utrwalone skrawki inkubowano z Ab B5, a następnie skoniugowanym z fluoresceiną fragmentem AffiniPure Fab koziego anty-króliczego IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, Pennsylvania, USA). Następnie skrawki inkubowano z A2B, a następnie nietkniętą IgG AffiniPure koziego anty-królika, sprzężoną z czerwonym barwnikiem Texas. Fluorescencję fluoresceiny obserwowano przy długości fali wzbudzenia 495 nm i emisji powyżej 515 nm. Fluorescencję czerwieni Texas zaobserwowano przy wzbudzeniu 510 nm i emisji powyżej 580 nm. W niektórych testach, Ab B5 został zastąpiony Ab przeciwko poszczególnym znanym hormonom przysadkowym zapewnionym przez National Pituitary and Hormone Distribution (NIH, Bethesda, Maryland, USA). Oczyszczanie heterodimeru A2 / B5 z zastosowaniem szybkiej chromatografii cieczowej białka i stymulacji ludzkich receptorów TSH. Kondycjonowane pożywki z komórek 293T wykazujących ekspresję A2 i B5 zastosowano do koncentratorów Ultrafree z masą cząsteczkową odcięcia między 10 a 100 kDa (Millipore Corp., Bedford, Massachusetts, USA)
[hasła pokrewne: płatki owsiane na wodzie, bartnik pl, finasteryd skutki uboczne ]
[hasła pokrewne: ostry dyzur okulistyczny, klinika stomatologiczna łódź, carcinoma adenoides cysticum ]